T7 RNA Polymerase

Catalog #: EG-1060

Qty:

Description	T7 RNA Polymerase catalyzes the 5'->3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from a T7 phage promoter (`TAATACGACTCACTATAGGGAGA`).
Applications	Radiolabeled RNA probe preparation RNA generation for in vitro translation RNA generation for studies of RNA structure, processing and catalysis Expression control via anti-sense RNA
Source	Purified from a strain of E. coli that expresses the recombinant T7 RNA Polymerase gene (gene I)
Unit Definition	One unit is defined as the amount of enzyme that will incorporate 1 nmol of ATP into acid-precipitable material in 1 hour at 37°C.
Components	T7 RNA Polymerase: 50,000 U/ml in 50 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, 0.1 mM EDTA, 50% glycerol, 0.1% Triton X-100, pH 7.9 @ 25°C 10X Reaction Buffer: 400 mM Tris-HCl, 60 mM MgCl₂, 100 mM DTT, 20 mM, Spermidine, pH 7.9 @ 25°C
Quality Control	The absence of endo-, exodeoxyribonucleases and ribonucleases confirmed by appropriate tests. Functionally tested in in vitro transcription reaction.
Storage Condition	-20 °C

Home \| Privacy Policy \| Terms & Conditions \| Online Price Policy \| Shipping & Return